martes, 16 de diciembre de 2008

A PESAR DE MIS CABELLOS RUBIOS

Hermanos míos:
a pesar de mis cabellos rubios,
yo soy asiático;
a pesar de mis ojos azules,
africano.
Entre los míos, allá lejos,
los árboles no tienen sombra al pie:
igual que los de ustedes, allá lejos...
Entre los míos, allá lejos,
al pan diario se lo traga el león
y acuestan a los dragones delante de las fuentes.
Y, entre los míos, mueren sin cumplir los cincuenta,
lo mismo que entre ustedes, allá lejos...

A pesar de mis cabellos rubios,
yo soy asiático;
a pesar de mis ojos azules,
africano.
El ochenta por ciento de los míos
no sabe leer ni escribir
y los poemas, yendo de boca en boca,
llegan a ser canciones,
allá, entre los míos, los poemas
llegan a ser banderas,
lo mismo que entre ustedes, allá lejos...


Nazim Hikmet

La canción del jinete (fragmento)

El más bello de los mares,
es aquel que no hemos visto.
La más linda criatura
todavía no ha nacido.
Nuestros días más hermosos
aún no los hemos vivido.
Y lo mejor de todo aquello que tengo que decirte
todavía no lo he dicho.


Nazim Hikmet

sábado, 29 de noviembre de 2008

Minicuentos

CASTIGO

Y levantando el látigo dijo:
"No sé leer pero me escriben".


Walter Lingán.




INCÓGNITA

Una persona es lo que cree ser, lo que los demás opinan que es y lo que realmente es. Desde esta perspectiva, no se pudo averiguar quien cometió el asesinato.


Carmen Peire.




EL SILLÓN

Me arrellano en mi sillón junto a la chimenea donde crepita el fuego, con la copa de coñac en la mano derecha y la izquierda caída descuidadamente, acariciando la cabeza de mi perro... hasta que descubro que no tengo perro.


Arthur Conan Doyle.

miércoles, 26 de noviembre de 2008

El viento que todo empuja

Hoy me detuve en tu mirada que raja el velo del dolor
Y supe que hay mucho más que percibir en este mundo
Que todo lo muele y los desgarra
Perdido por perdido ya ves da lo mismo vivo o muerto
Pero tu alma es otra cosa, tu alma es la que te mueve
Tu alma es mi razón, tu alma es la fuerza
El águila muerte siempre huele y afina su aguda vista
Hoy cualquiera puede morir sin saber cómo fue vivir
Yo sólo espero, sin dormirme en mis sueños
Estar tan lejos, lejos de esa ignorancia
Sólo eso, sólo eso
Despierta en mi el viento que todo empuja
Sólo eso, sólo eso
Qué más puedo esperar, sólo eso
Y mi mirada puede ver por la rejilla de tus ojos
Para espiar tu corazón que se quedó
con un pedazo de mi vida
Al tiempo que yo, yo broté de tu sangre
Hoy que no hay tiempo que perder,
Que todo anda a reloj
Que se destruye sin razón
Y la vida muere en un discurso
Y alguien se encarga de encerrarte
Y otro prepara el fin del mundo
Y tan lejana queda la escencia
Que sólo el hecho de encontrarte para mí
Le da sentido, le da sentido a mi vida
Sólo eso, sólo eso
Despierta en mi el viento que todo empuja
Sólo eso, sólo eso
Qué más puedo esperar, sólo eso.


La Renga

sábado, 15 de noviembre de 2008

Poema 20

Puedo escribir los versos más tristes esta noche.

Escribir, por ejemplo: "La noche está estrellada,
y tiritan, azules, los astros, a lo lejos."

El viento de la noche gira en el cielo y canta.

Puedo escribir los versos más tristes esta noche.
Yo la quise, y a veces ella también me quiso.

En las noches como esta la tuve entre mis brazos.
La besé tantas veces bajo el cielo infinito.

Ella me quiso, a veces yo también la quería.
Cómo no haber amado sus grandes ojos fijos.

Puedo escribir los versos más tristes esta noche.
Pensar que no la tengo. Sentir que la he perdido.

Oir la noche inmensa, más inmensa sin ella.
Y el verso cae al alma como al pasto el rocío.

Qué importa que mi amor no pudiera guardarla.
La noche esta estrellada y ella no está conmigo.

Eso es todo. A lo lejos alguien canta. A lo lejos.
Mi alma no se contenta con haberla perdido.

Como para acercarla mi mirada la busca.
Mi corazón la busca, y ella no está conmigo.

La misma noche que hace blanquear los mismos árboles.
Nosotros, los de entonces, ya no somos los mismos.

Ya no la quiero, es cierto, pero cuánto la quise.
Mi voz buscaba el viento para tocar su oído.

De otro. Será de otro. Como antes de mis besos.
Su voz, su cuerpo claro. Sus ojos infinitos.

Ya no la quiero, es cierto, pero tal vez la quiero.
Es tan corto el amor, y es tan largo el olvido.

Porque en noches como esta la tuve entre mis brazos,
mi alma no se contenta con haberla perdido.

Aunque este sea el ultimo dolor que ella me causa,
y estos sean los ultimos versos que yo le escribo.


Pablo Neruda.

miércoles, 29 de octubre de 2008

Pensamiento

A bañarse en la gota de rocío
que halló en las fores vacilante cuna,
en las noches de estío,
desciende el rayo de la blanca luna.
Así, en las horas de celeste calma
y dulce desvarío,
hay en mi alma una gota de tu alma
donde se baña el pensamiento mío.

Rafael Obligado

martes, 28 de octubre de 2008

El cielo del desengaño

Hoy se ha nublado para llorar...

Como esas nubes que ahora ves,
que van regando de vida los campos,
así lloraba de vez en vez,
la tristeza del desengaño.

Haberse visto en la soledad,
esa que aman los sabios,
hoy se ha nublado para llorar,
todo el cielo que te he confiado.

Como un ciego...
que apunta al ruido de mi cabeza,
como todo, como siempre, como es sin ver...

Hacia el abismo de sed,
que no calma el agua, ni las lágrimas,
como todo, como siempre, como es sin ver.

Como esas nubes que ahora ves,
que van regando de vida los campos,
así lloraba de vez en vez,
todo el cielo del desengaño.

La renga

martes, 21 de octubre de 2008

Soledad

Ellos tienen razón esa felicidad
al menos con mayúscula no existe
ah pero si existiera con minúscula
seria semejante a nuestra breve presoledad.

Después de la alegría viene la soledad
después de la plenitud viene la soledad
después del amor viene la soledad.

Ya se que es una pobre deformación
pero lo cierto es que en ese durable
minuto uno se siente solo en el mundo.

Sin asideros, sin pretextos
sin abrazos, sin rencores
sin las cosas que unen o separan
y en es sola manera de estar solo
ni siquiera uno se apiada de uno mismo.

Los datos objetivos son como sigue.

Hay diez centímetros de silencio
entre tus manos y mis manos una
frontera de palabras no dichas
entre tus labios y mis labios
y algo que brilla así de triste
entre tus ojos y mis ojos claro
que la soledad no viene sola.

Si se mira por sobre el hombro mustio
de nuestras soledades se vera un
largo y compacto imposible un sencillo
respeto por terceros o cuartos
ese percance de ser buenagente.

Después de la alegría
Después de la plenitud
Después del amor
Viene la soledad.

Conforme pero
que vendrá después
de la soledad.

A veces no me siento tan solo
si imagino mejor dicho si se
que mas allá de mi soledad y de
la tuya otra vez estas vos
aunque sea preguntándote a solas
que vendrá después de la soledad.

Mario Benedetti

lunes, 13 de octubre de 2008

Las lineas de la mano

De una carta tirada de una mesa sale una línea que corre por la plancha de pino y baja por una pata. Basta mirar bien para descubrir que la línea continúa por el piso de parqué, remonta el muro, entra en una lámina que reproduce un cuadro de Boucher, dibuja la espalda de una mujer reclinada en un diván, y por fin escapa de la habitación por el techo y desciende en la cadena del pararrayos hasta la calle. Ahí es difícil seguirla a causa del tránsito pero con atención se la verá subir por la rueda del autobús estacionado en la esquina que lleva al puerto. Allí baja por la media de nilón cristal de la pasajera más rubia, entra en el territorio hostil de las aduanas, rampa y repta y zizaguea hasta el muelle mayor, y allí (pero es difícil verla, sólo las ratas la siguen para trepar a bordo) sube al barco de turbinas sonoras, corre por las planchas de la cubierta de primera clase, salva con dificultad la escotilla mayor, y en una cabina donde un hombre triste bebe coñac y escucha la sirena de partida, remonta por la costura del pantalón, por el chaleco de punto, se desliza hasta el codo, y con un último esfuerzo se guarece en la palma de la mano derecha, que en ese instante empieza a cerrarse sobre la culata de una pistola.


Julio Cortázar

miércoles, 8 de octubre de 2008

A la orilla de la chimenea

Puedo ponerme cursi y decir
que tus labios me saben igual que los labios
que beso en mis sueños,
puedo ponerme triste y decir
que me basta con ser tu enemigo, tu todo,
tu esclavo, tu fiebre, tu dueño.

Y si quieres tambien
puedo ser tu estacion y tu tren,
tu mal y tu bien,
tu pan y tu vino,
tu pecado, tu dios, tu asesino…

O tal vez esa sombra
que se tumba a tu lado en la alfombra
a la orilla de la chimenea
a esperar que suba la marea.

Puedo ponerme humilde y decir
que no soy el mejor
que me falta valor para atarte a mi cama,
puedo ponerme digno y decir
“toma mi direccion cuando te hartes de amores
baratos de un rato… me llamas”.

Y si quieres tambien
puedo ser tu trapecio y tu red,
tu adios y tu “ven”,
tu manta y tu frio,
tu resaca, tu lunes, tu hastio…

O tal vez ese viento
que te arranca del aburrimiento
y te deja abrazada a una duda,
en mitad de la calle y desnuda.

Y si quieres tambien
puedo ser tu abogado y tu juez,
tu miedo y tu fe
tu noche y tu dia.

Tu rencor, tu por que, tu agonia…
o tal vez esa sombra
que se tumba a tu lado en la alfombra
a la orilla de la chimenea
a esperar que suba la marea.

Joaquín Sabina





"Quién no se ha enamorado de alquien que anda por la vida sin tomarla en serio, y nos enamoramos de su libertad y su incertidumbre?, sabemos que podemos hacerlos felices, y ser plenos con ellos… Pero sabemos que esa libertad nos deja fuera de sus vidas…
-toma mi direccion cuando te hartes de amores
baratos de un rato… me llamas."

sábado, 4 de octubre de 2008

Poema a la clase media

Clase media
medio rica
medio culta
entre lo que cree ser y lo que es
media una distancia medio grande
Desde el medio mira medio mal
a los negritos
a los ricos a los sabios
a los locos
a los pobres
Si escucha a un Hitler
medio le gusta
y si habla un Che
medio también
En el medio de la nada
medio duda
como todo le atrae (a medias)
analiza hasta la mitad
todos los hechos
y (medio confundida) sale a la calle con media cacerola
entonces medio llega a importar
a los que mandan(medio en las sombras)
a veces, solo a veces, se dá cuenta(medio tarde)
que la usaron de peón
en un ajedrez que no comprende
y que nunca la convierte en Reina
Así, medio rabiosa
se lamenta(a medias)
de ser el medio del que comen otros
a quienes no alcanza a entender
ni medio.


Mario Benedetti

miércoles, 1 de octubre de 2008

La vida ha terminado. Ahora empieza la supervivencia

El presidente de los Estados Unidos, Franklin Pierce, envía en 1854 una oferta al jefe Seattle, de la tribu Suwamish, para comprarle los territorios del noroeste de los Estados Unidos que hoy forman el Estado de Washington. A cambio, promete crear una "reserva" para el pueblo indígena. El jefe Seattle responde en 1855.

El Gran Jefe de Washington manda decir que desea comprar nuestras tierras.

El Gran Jefe también nos envía palabras de amistad y buena voluntad. Apreciamos esta gentileza porque sabemos qué poca falta le hace, en cambio nuestra amistad. Vamos a considerar su oferta, pues sabemos que, de no hacerlo, el hombre blanco podrá venir con sus armas de fuego y tomar nuestras tierras.

El Gran Jefe de Washington podrá confiar en lo que dice el Jefe Seattle con la misma certeza con que nuestros hermanos blancos podrán confiar en la vuelta a sus estaciones.

Mis palabras son inmutables como las estrellas.

¿Cómo podeís comprar o vender el cielo, el calor de la tierra? Esta idea nos parece extraña. No somos dueños de la frescura del aire ni del centelleo del agua. ¿Cómo podríais comprarlos a nosotros? Lo decimos oportunamente. Habéis de saber que cada partícula de esta tierra es sagrada para mi pueblo.

Cada hoja resplandeciente, cada playa arenosa, cada neblina en el oscuro bosque, cada claro y cada insecto con su zumbido son sagrados en la memoria y en la experiencia de mi pueblo. La savia que circula en los árboles porta la memoria del hombre piel roja. Los muertos del hombre blanco se olvidan de su tierra natal cuando se van a caminar por las estrellas.

Nuestros muertos jamás olvidan esta hermosa tierra porque ella es la madre del hombre piel roja. Somos parte de la tierra y ella es parte de nosotros.

Las fragantes flores son nuestras hermanas; el venado, el caballo, el águila majestuosa son nuestros hermanos. Las crestas rocosas, las savias de las praderas, el calor corporal del potrillo y del hombre, todos pertenecen la misma familia.

Por eso, cuando el Gran Jefe de Washington manda a decir que desea comprar nuestras tierras , es mucho lo que pide. El Gran Jefe manda decir que nos reservará un lugar para que podamos vivir cómodamente entre nosotros. El será nuestro padre y nosotros seremos sus hijos.

Por eso consideramos su oferta de comprar nuestras tierras. Mas ello no será fácil porque estas tierras son sagradas para nosotros.

El agua centelleante que corre por los ríos y esteros no es meramente agua sino la sangre de nuestros antepasados. Si os vendemos estas tierras, tendréis que recordar que ellas son sagradas y deberéis enseñar a vuestros hijos que lo son, y que cada reflejo fantasmal en las aguas claras de los lagos habla de acontecimientos y recuerdos de la vida de mi pueblo.

El murmullo del agua es la voz del padre de mi padre. Los ríos son nuestros hermanos, ellos calman nuestra sed. Los ríos llevan nuestras canoas y alimentan a nuestros hijos.

Si os vendemos nuestras tierras deberéis recordar a vuestros hijos que los ríos son nuestros hermanos y hermanos de vosotros; deberéis en adelante dar a los ríos el trato bondadoso que daréis a cualquier hermano.

Sabemos que el hombre blanco no comprende nuestra manera de ser.

Le da lo mismo un pedazo de tierra que el otro porque él es un extraño que llega en la noche a sacar de la tierra lo que él necesita.

La tierra no es su hermano sino un enemigo.

Cuando la ha conquistado la abandona y sigue su camino. Deja detrás de él las sepulturas de sus padres sin que le importe. Despoja de la tierra a sus hijos sin que le importe. Olvida la sepultura de su padre y los derechos de sus hijos.

Trata a su madre la tierra, y a su hermano el cielo como si fuesen cosas que se pueden comprar, saquear y vender, como si fueran corderos y cuentas de vidrio.

Su insaciable apetito devorará la tierra y dejará tras de sí sólo un desierto.

No lo comprendo. Nuestra manera de ser es diferente a la vuestra.

La vista de vuestras ciudades hace doler los ojos al hombre de piel roja.

Pero quizás sea así porque el hombre de piel roja es un salvaje y no comprende las cosas. No hay ningún lugar tranquilo en las ciudades del hombre blanco, ningún lugar donde pueda escucharse el desplegarse de las hojas en primavera o el rozar de las alas de un insecto.

Pero quizás sea así porque soy un salvaje y no puedo comprender las cosas.

El ruido de la ciudad parece insultar los oídos. ¿Y qué clase de vida es cuando el hombre no es capaz de escuchar el solitario grito de la garza o la discusión nocturna de las ranas alrededor de la laguna?

Soy un hombre de piel roja y no lo comprendo. Los indios preferimos el suave sonido del viento que acaricia la cala del lago y el olor del mismo viento purificado por la lluvia del mediodía o perfumado por la fragancia de los pinos.

El aire es algo precioso para el hombre de piel roja porque todas las cosas comparten el mismo aliento: el animal, el árbol y el hombre.

El hombre blanco parece no sentir el aire que respira. Al igual que un hombre muchos días agonizante se ha vuelto insensible al hedor.

Mas, si os vendemos nuestras tierras, debéis recordar que el aire es precioso para nosotros, que el aire comparte su espíritu con toda la vida que sustenta.

Y si os vendemos nuestras tierras, debéis dejarlas aparte y mantenerlas sagradas como un lugar al cual podrá llegar incluso el hombre blanco a saborear el viento dulcificado por las flores de la pradera.

Consideraremos vuestra oferta de comprar nuestras tierras. Si decidimos aceptarla, pondré una condición: que el hombre blanco deberá tratar a los animales de estas tierras como a sus hermanos.

Soy un salvaje y no entiendo otro modo de conducta. He visto a miles de búfalos pudriéndose sobre las praderas, abandonados allí por el hombre blanco que les disparó desde un tren en marcha.

Soy un salvaje y no comprendo cómo el humeante caballo de vapor puede ser más importante que el búfalo al que sólo matamos para poder vivir. ¿Qué es el hombre sin los animales? Si todos los animales hubiesen desaparecido el hombre moriría de una gran soledad de espíritu.

Porque todo lo que ocurra a los animales pronto habrá de ocurrir también al hombre.

Todas las cosas están relacionadas entre sí.

Vosotros debéis enseñar a vuestros hijos que el suelo bajo sus pies es la ceniza de sus abuelos. Para que respeten la tierra, debéis decir a vuestros hijos que la tierra está plena de la vida de nuestros antepasados.

Debéis enseñar a vuestros hijos lo que nosotros hemos enseñado a los nuestros: que la tierra es nuestra madre.

Todo lo que afecta a la tierra afecta a los hijos de la tierra. Cuando los hombres escupen sobre el suelo se escupen a sí mismos.

Esto lo sabemos: la tierra no le pertenece al hombre, sino que el hombre pertenece a la tierra.

El hombre no ha tejido la red de la vida: es sólo una hebra de ella. Todo lo que haga a la red se lo hará a sí mismo. Lo que ocurre a la tierra ocurrirá a los hijos de la tierra. Lo sabemos.

Todas las cosas están relacionadas como la sangre que une a la familia. Aún el hombre blanco, cuyo dios se pasea con él y conversa con él de amigo a amigo, no puede estar exento del destino común. Quizás seamos hermanos después de todo. Lo veremos. Sabemos algo que el hombre blanco descubrirá algún día: que nuestro dios es su mismo dios.

Ahora pensáis que quizás sois dueños de nuestra tierra: pero no podréis serlo.

El es el dios de la humanidad y su compasión es igual para el hombre de piel roja como para el hombre blanco.

Los hombres blancos también pasarán, tal vez antes que las demás tribus.

Si contamináis vuestra cama, moriréis alguna noche sofocados por vuestros propios desperdicios.

Pero aún en vuestra hora final os sentiréis iluminados por la idea de que dios os trajo a estas tierras y os dió el dominio sobre ellas y sobre el hombre de la piel roja con algún propósito especial.

Tal destino es un misterio para nosotros porque no comprendemos lo que será cuando los búfalos sean exterminados, cuando los caballos salvajes hayan sido domados, cuando los recónditos rincones de los bosques exhalen el olor a muchos hombres y cuando la vista hacia las verdes colinas esté cerrada por un enjambre de alambres parlantes.

¿Dónde está el espeso bosque? Desapareció. ¿Dónde está el águila? Desapareció. Así termina la vida y comienza el sobrevivir.

lunes, 29 de septiembre de 2008

lunes, 22 de septiembre de 2008

Instinto Primitivo

Fuimos nómadas desde los comienzos. Conocíamos la posición de cada árbol en cien millas a la redonda. Cuando sus frutos o nueces habían madurado, estábamos allí. Seguíamos a los rebaños en sus migraciones anuales. Disfrutábamos con la carne fresca. Con sigilo, haciendo amagos, organizando emboscadas y asaltos a fuerza viva, cooperando unos cuantos conseguíamos lo que muchos de nosotros, cazando por separado, nunca habríamos logrado. Dependíamos los unos de los otros. Actuar de forma individual resultaba tan grotesco de imaginar como establecernos en lugar fijo.
Trabajando juntos protegíamos a nuestros hijos de los leones y las hienas. Les enseñábamos todo lo que iban a necesitar. También el uso de las herramientas. Entonces, igual que ahora, la tecnología constituía un factor clave para nuestra supervivencia.
Cuando la sequía era prolongada o si un frío inquietante persistía en el aire veraniego, nuestro grupo optaba por ponerse en marcha, muchas veces hacia lugares desconocidos. Buscábamos un entorno mejor. Y cuando surgían problemas entre nosotros en el seno de la pequeña banda nómada la abandonábamos en busca de compañeros más amistosos. Siempre podíamos empezar de nuevo.
Durante el 99.9 % del tiempo desde que nuestra especie inició la andadura fuimos cazadores y forrajeadores, nómadas moradores de las sábanas y las estepas. Entonces, no había guardias fronterizos ni personal de aduanas. La frontera estaba en todas partes. Únicamente nos limitaba la tierra, el océano y el cielo; y, ocasionalmente, algún vecino hostil.
No obstante, cuando el clima era benigno y el alimento abundante estábamos dispuestos a permanecer en lugar fijo. Sin correr riesgos. Sin sobrecargas. Sin preocupaciones. En los últimos diez mil años –un instante en nuestra larga historia- hemos abandonado la vida nómada. Hemos domesticado a animales y plantas. ¿Por qué molestarse en cazar el alimento, cuando podemos conseguir que este acuda a nosotros?
Con todas sus ventajas materiales, la vida sedentaria nos ha dejado un rastro de inquietud, de insatisfacción. Incluso tras cuatrocientas generaciones en pueblos y ciudades, no hemos olvidado. El campo abierto sigue llamándonos quedamente, como una canción de infancia ya casi olvidada. Conquistamos lugares remotos con cierto romanticismo. Esa atracción, sospecho, se ha ido desarrollando cuidadosamente, por selección natural, como un elemento esencial para nuestra supervivencia. Veranos largos, inviernos suaves, buenas cosechas, caza abundante; nada de eso es eterno. No poseemos la facultad de predecir el futuro. Los eventos catastróficos están al acecho, nos cogen desprevenidos. Quizá debamos nuestra propia existencia, la de nuestra banda o incluso la de nuestra especie a unos cuantos personajes inquietos, atraídos por un ansia que apenas eran capaces de articular o comprender hacia nuevos mundos y tierras por descubrir.
Herman Melville, en Moby Dick, habla a favor de los aventureros de todas épocas y latitudes:”Me agita una atracción permanente hacia las cosas remotas. Adoro surcar mares prohibidos…”
Para los antiguos griegos y romanos, El mundo conocido comprendía Europa, y unas Asia y África limitadas, rodeadas de un mundo oceánico infranqueable. Los viajeros podían toparse con seres inferiores, a los que llamaban bárbaros, o bien con seres superiores, que eran los dioses. Todo árbol poseía su dríade (Ninfa de los bosques, cuya vida duraba lo que el árbol a que se suponía unida, definición de Julio Casares), toda región su héroe legendario. Pero no había muchos dioses, al menos al principio, quizá solo unas cuantas docenas. Habitaban en las montañas, bajo la superficie de la tierra, en el mar o ahí arriba, en el cielo. Enviaban mensajes a los hombres, intervenían en los asuntos humanos y se cruzaban con nuestra especie.
Con el paso del tiempo, cuando el hombre descubrió su capacidad de explorar, empezaron las sorpresas: los bárbaros podían ser tan ingeniosos como los griegos y los romanos. África y Asia eran más extensas de lo que nadie había imaginado. El mundo oceánico no era infranqueable. Existían las antípodas (en cuanto a la fábula de que existen antípodas –escribió san Agustín en el siglo v-, es decir, personas en el extremo opuesto de la Tierra, donde el sol sale cuando se pone para nosotros y cuyos habitantes caminan con los pies opuestos a los nuestros, no es creíble en modo alguno. Incluso en el caso de que allí existiera una gran masa de tierra desconocida y no sólo océano, únicamente hubo una pareja de antepasados originales, y es de todo punto inconcebible que regiones tan distantes pudieran ser pobladas por los descendientes de Adán). También se supo de tres nuevos continentes, que habían sido colonizados por los asiáticos en tiempos pasados sin que tales noticias alcanzaran nunca a Europa. Por otra parte, los dioses resultaban decepcionantemente difíciles de encontrar.
La primera migración humana a gran escala del Viejo Mundo al Nuevo se produjo durante el último período glaciar, unos 11500 años atrás, cuando las crecientes capas de hielo polar rebajaron la profundidad de los océanos e hicieron posible el traslado por terreno sólido desde Siberia hasta Alaska. Mil años después llegábamos a Tierra del Fuego, la punta más al sur de Sudamérica. Mucho antes que Colón, aeronautas indonesios en canoas con balancín exploraron la parte occidental del Pacífico; oriundos de Borneo se establecieron en Madagascar; egipcios y libios circunnavegaron África; e incluso hubo una gran flota de juncos de alta mar, perteneciente a la dinastía china Ming, que cruzó el océano Índico, estableció una base en Zanzíbar, rodeo el cabo Buena Esperanza y penetró en el océano Atlántico. Entre los siglos XV y XVII, barco de velas europeos descubrieron continentes (nuevos, claro está, para los europeos) y circunnavegaron el planeta. En los siglos XVIII y XIX., exploradores americanos y rusos, mercaderes y colonos rivalizaron en su carrera por este y oeste, a través de dos vastos continentes hacia el Pacífico. Este entusiasmo desenfrenado por explorar y explorar, con independencia de lo irreflexivos que fueran quienes lo materializaron, entraña un claro valor de supervivencia. No se circunscribe a ninguna nación o grupo étnico concreto. Remite a un don que compartimos toda la especie humana.
Desde el momento en que surgimos, hace unos cuantos millones de años en el este de África, hemos ido forjando nuestro camino a través del planeta. Hoy hay gente en todos los continentes, en la isla más remota, de polo a polo, desde el Everest hasta el mar Muerto, en las profundidades del océano e incluso, ocasionalmente, puede haber humanos acampando a trecientos kilómetros cielo arriba, como los dioses de la antigüedad.
En los tiempos que corren parece que ya no queda nada por explorar, al menos en el área terrestre de nuestro planeta. Víctimas de su notable éxito, hoy en día la gran mayoría de los exploradores prefieren quedarse en casa.
Importantes migraciones de población –algunas voluntarias, pero la mayoría no- han modelado la condición humana. Hoy son mucho más numerosas las personas que se ven obligadas a huir de la guerra, la represión y la hambruna que en ningún otro período de la historia humana. Y dado que el clima de la tierra va a cambiar en las próximas décadas, es muy probable que aumente extraordinariamente las cifras de refugiados medioambientales. Siempre acudiremos a la llamada de lugares más propicios. Las mareas humanas continuarán creciendo y menguando alrededor del planeta. Sin embargo, los países que han de acogernos hoy en día ya están poblados. Otras personas, a menudo poco comprensivas con nuestra situación, han llegado allí antes que nosotros.


Un Punto Azul Pálido
Carl Sagan

viernes, 19 de septiembre de 2008

martes, 16 de septiembre de 2008

Enemigos Naturales

Sábado, 8 de abril, 1962

En nuestras conversaciones, don Juan usaba a menudo la frase "hombre de conocimiento", o se refería a ella, pero nunca explicaba qué quería decir. Inquirí al respecto.
-Un hombre de conocimiento es alguien que ha seguido de verdad las penurias de aprender - dijo – Un hombre que, sin apuro, sin vacilación ha ido lo más lejos que puede en desenredar los secretos del poder y el conocimiento.
-¿Puede cualquiera ser un hombre de conocimiento?
-No, no cualquiera.
-¿Entonces qué debe hacer un hombre para volverse hombre de conocimiento?
-Debe desafiar y vencer a sus cuatro enemigos naturales.
-¿Será un hombre de conocimiento tras derrotar a estos cuatro enemigos?
-Sí. Un hombre puede llamarse hombre de conocimiento sólo si es capaz de vencer a los cuatro.
-Entonces, ¿puede cualquiera que venza a estos enemigos ser un hombre de conocimiento?
-Todo el que los venza se convierte en un hombre de conocimiento.
-¿Pero hay requisitos especiales que un hombre debe cumplir antes de luchar con estos enemigos?
-No hay requisitos. Cualquiera puede tratar de llegar a ser un hombre de conocimiento; muy pocos llegan a serlo, pero eso es natural. Los enemigos que un hombre encuentra en el camino para llegar a ser un hombre de conocimiento son de verdad formidables, de verdad poderosos; y la mayoría, pues, se pierde.
-¿Qué clase de enemigos son, don Juan?
Se negó a hablar de los enemigos. Dijo que pasaría largo tiempo antes de que el tema tuviera algún sentido para mí. Traté de mantener vivo ese tema, y le pregunté si pensaba que yo podía volverme hombre de conocimiento. Dijo que nadie podía decir eso de seguro. Pero yo insistí en preguntar si había algunas pistas que él pudiera usar para determinar si yo tenía o no oportunidad de convertirme en hombre de conocimiento. Dijo que dependería de mi batalla contra los cuatro enemigos –de si podía yo vencerlos o salía vencido- pero que era imposible predecir el resultado de esa lucha.
Le pregunté si podía usar brujería o adivinación para ver el desenlace de la batalla. Dijo terminantemente que los resultados de la contienda no podían anticiparse por ningún medio, porque volverse hombre de conocimiento era cosa temporal. Cuando le pedí explicar este punto, replicó:
-Ser hombre de conocimiento no tiene permanencia. Uno no es nunca en realidad un hombre de conocimiento. Más bien, uno se hace hombre de conocimiento por un instante de conocimiento muy corto, después de vencer a los cuatro enemigos naturales.
-Debe usted decirme, don Juan, qué clase de enemigos son.
No respondió. Insistí, pero él abandonó el tema y se puso a hablar de otra cosa.

Domingo, 15 de abril, 1962

Cuando me disponía a partir, decidí preguntarle una vez más por los enemigos de un hombre de conocimiento. Aduje que no podría regresar en algún tiempo y sería buena idea escribir lo que él dijese y meditar en ello mientras estaba fuera.
Titubeó un rato, pero luego empezó a hablar.
-Cuando un hombre empieza a aprender, nunca sabe lo que va a encontrar. Su propósito es deficiente; su intención es vaga. Espera recompensas que nunca llegarán, pues no sabe nada de los trabajos que cuesta aprender.
“Pero uno aprende así, poquito a poquito al comienzo, luego más y más. Y sus pensamientos se dan de topetazos y se hunden en la nada. Lo que se aprende no es nunca lo que uno cría. Y así se comienza a tener miedo. El conocimiento no es nunca lo que uno se espera. Cada paso del aprendizaje es un atolladero, y el miedo que el hombre experimenta empieza a crecer sin misericordia, sin ceder. Su propósito se convierte en un campo de batalla.
“Y así ha tropezado con el primero de sus enemigos naturales: el miedo! Un enemigo terrible: traicionero y enredado como los cardos. Se queda oculto en cada recodo del camino, acechando. Y si el hombre, aterrado en su presencia, echa a correr, su enemigo habrá puesto fin a su búsqueda”.
-¿Qué le pasa al hombre si corre por miedo?
-Nada le pasa, sólo que jamás aprenderá. Nunca llegará a ser hombre de conocimiento. Llegará a ser un maleante, o un cobarde cualquiera, un hombre inofensivo, asustado; de cualquier modo, será un hombre vencido. Su primer enemigo habrá puesto fin a sus ansias.
-¿Y qué puede hacer para superar el miedo?
-La respuesta es muy sencilla. No debe correr. Debe desafiar a su miedo, y pese a él debe dar el siguiente paso en su aprendizaje, y el siguiente, y el siguiente. Debe estar lleno de miedo, pero no debe detenerse. Esa es la regla! Y llega un momento en que su primer enemigo se retira. El hombre empieza a sentirse seguro de si. Su propósito se fortalece. Aprender no es ya una tarea aterradora.
“cuando llega ese momento gozoso, el hombre puede decir sin duda que ha vencido a su primer enemigo natural”.
-¿Ocurre de golpe, don Juan, o poco a poco?
-Ocurre poco a poco, y sin embargo el miedo se conquista rápido y de repente.
-¿Pero no volverá el hombre a tener miedo si algo nuevo le pasa?
-No. Una vez que el hombre ha conquistado el miedo, está libre de él por el resto de su vida, porque a cambio del miedo, ha adquirido la claridad: una claridad de mente que borra el miedo. Para entonces, un hombre conoce sus deseos; sabe cómo satisfacer esos deseos. Puede preveer los nuevos pasos del aprendizaje, y una claridad nítida lo rodea todo. El hombre siente que nada está oculto. Y así ha encontrado a segundo enemigo: la claridad! Esa claridad de mente, tan difícil de obtener, dispersa el miedo pero también ciega.
“fuerza al hombre a no dudar nunca de si. Le da la seguridad de que puede hacer cuanto se le antoje, porque todo lo que ve lo ve con claridad. Y tiene valor porque tiene claridad, y no se detiene en nada porque tiene claridad. Pero todo eso es un error; es como si viera algo claro pero incompleto. Si el hombre se rinde ante esa ilusión de poder, ha sucumbido a su segundo enemigo y será torpe para aprender. Se apurará cuando debía ser paciente, o será paciente cuando debía apurarse. Y tonteará con el aprendizaje, hasta que termine incapaz de aprender nada más.
-¿Qué pasa con un hombre derrotado de esa forma, don Juan? ¿Muere en consecuencia?
-No, no muere. Su segundo enemigo nomás aparado en seco sus intentos de hacerse hombre de conocimiento; en vez de eso, el hombre puede volverse un guerrero impetuoso, o un payaso. Pero la claridad que tan caro ha pagado, no volverá a transformarse en oscuridad y miedo. Será claro mientras viva, pero ya no aprenderá ni ansiará nada.
-Pero ¿qué tiene que hacer para evitar la derrota?
-Debe hacer lo que hizo con el miedo: debe desafiar su claridad y usarla sólo para ver, y esperar con paciencia y medir con tiento antes de dar otros pasos; debe pensar, sobre todo, que su claridad es casi un error. Y vendrá un momento en que comprenderá que su claridad era sólo un punto delante de sus ojos. Y así habrá vencido a su segundo enemigo, y llegará a una posición donde nada puede ya dañarlo. Esto no será un error ni tampoco una ilusión. No será solamente un punto delante de sus ojos. Ése será el verdadero poder.
“Sabrá entonces que el poder tanto tiempo perseguido es suyo por fin. Puede hacer con él lo que se le antoje. Su aliado está a sus órdenes. Su deseo es la regla. Ve claro y parejo todo cuanto hay alrededor. Pero también ha tropezado con su tercer enemigo: el poder!
“El poder es el más fuerte de todos los enemigos. Y naturalmente lo más fácil es rendirse; después de todo, el hombre es de veras invencible. Él manda; empieza tomando riesgos calculados y termina haciendo reglas, porque es el amo del poder.
“Un hombre en esta etapa apenas advierte que su tercer enemigo se cierne sobre él. Y de pronto, sin saber, habrá sin duda perdido la batalla. Su enemigo lo habrá transformado en un hombre cruel, caprichoso”.
-¿Perderá su poder?
-No, nunca perderá su claridad ni su poder.
-Entonces, ¿qué lo distinguirá de un hombre de conocimiento?
-Un hombre vencido por su poder, muere sin saber realmente cómo manejarlo. El poder es solo una carga sobre su destino. Un hombre así no tiene dominio de si mismo, ni puede decir cómo ni cuando usar su poder.
-¿La derrota a manos de cualquiera de estos enemigo es definitiva?
-Claro que es definitiva. Cuando uno de estos enemigos vence al hombre, no hay nada que se pueda hacer.
-¿Es posible por ejemplo, que el hombre vencido por el poder, vea su error y se corrija?
-No. Una vez que un hombre se rinde, está acabado.
-¿Pero si el poder lo ciega temporalmente y luego él lo rechaza?
-Eso quiere decir que la batalla sigue. Quiere decir que todavía está tratando de volverse hombre de conocimiento. Un hombre está vencido solo cuando ya no hace la lucha y se abandona.
-Pero entonces, don Juan, es posible que un hombre se abandone al miedo durante años, pero finalmente lo conquiste.
-No, eso no es cierto. Si se rinde al miedo nunca lo conquistará, porque se asustará de aprender y no volverá a hacer la prueba. Pero si trata de aprender durante años, en medio de su miedo, terminará conquistándolo porque nunca se habrá abandonado a él en realidad.
-¿Cómo puede vencer a su tercer enemigo, don Juan?
-Tiene que desafiarlo, con toda intención. Tiene que llegar a darse cuenta que el poder que aparentemente ha conquistado no es nunca suyo en verdad. Debe tenerse a raya a todas horas, manejando con tiento y con fe todo lo que ha aprendido. Si puede ver que, sin control sobre si mismo, la claridad y el poder son peores que los errores, llegará a un unto en el que todo se domina. Entonces sabrá como y cuando usar su poder. Y habrá vencido a su tercer enemigo.
“El hombre estará, para entonces, al fin de su travesía por el camino del conocimiento, y casi sin advertencia tropezará con su ultimo enemigo: la vejez! Este enemigo es el más cruel de todos, el único al que no se puede vencer por completo; el enemigo al que solamente podrá ahuyentar por un instante.
“Ese es el tiempo en que un hombre ya no tiene miedos. Ya no tiene claridad impaciente, un tiempo en que todo su poder está bajo control, pero también el tiempo en el que siente un deseo constante de descansar. Si se rinde por entero a su deseo de acostarse y olvidar, si se arrulla en la fatiga, habrá perdido el último asalto, y su enemigo lo reducirá a una débil criatura vieja. Su deseo de retirarse vencerá toda su claridad, su poder y su conocimiento.
“Pero si el hombre se sacude el cansancio y vive su destino hasta el final, puede entonces ser llamado hombre de conocimiento, aunque sea tan sólo por esos momentitos en que logra ahuyentar al último enemigo, el enemigo invencible. Esos momentos de claridad, poder y conocimiento son suficientes".


Las enseñanzas de don Juan (una forma yaqui de conocimiento)
Carlos Castaneda

martes, 26 de agosto de 2008

Pienso, luego existes



Mario Viñuela

domingo, 24 de agosto de 2008

El nacedor


¿Por qué será que el Che tiene esa peligrosa costumbre de seguir naciendo?
Cuanto más lo insultan, lo manipulan, lo traicionan, más nace.
Él es el más nacedor de todos.
¿No será porque el Che decía lo que pensaba y hacía lo que dicía?
No será que por eso sigue siendo tan extraordinario,
en un mundo donde las palabras y los hechos muy rara vez se encuentran,
y cuando se encuentran, no se saludan, porque no se reconocen.

Eduardo Galeano.

viernes, 22 de agosto de 2008

Tienes que decidir

Tienes que decidir
quién prefieres que te mate:
un comando terrorista
o tu propio gobierno para salvarte
del comando terrorista.

Tienes que decidir
qué prefieres que te mate:
la pobreza, la miseria,
el Tratado de Libre Comercio
o el programa contra el hambre.

Ya se acabó aquel tiempo
en que decidían cómo nos mataba
y sin preguntarnos si quiera por pura cortesía.
Si era nuestro deseo el de fenecer,
como los mosquitos al amanecer,
o morirnos de sed.

Ya nos mataron de tantas maneras,
ya nos cansamos de ir al panteón
ya no sabemos si somos ciiviles,
rehenes, vampiros o simples mortales.

Pero, de tanto morirnos
al menos nos hemos ganado el derecho
de decidir cómo queremos morir.

Tienes que decidir cómo prefieres morir:
de hambre natural,
de asco terminal,
de pago de predial,
ahorcada con tu chal,
debiendo un dineral,
cruzando de ilegal.

Ya se acabó aquel tiempo
en que decidían cómo nos mataba
y sin preguntarnos si quiera por pura cortesía.
Si era nuestro deseo el de fenecer,
como los mosquitos al amanecer,
o morirnos de sed.

Ya nos mataron de tantas maneras,
ya nos cansamos de ir al panteón
ya no sabemos si somos ciiviles,
rehenes, vampiros o simples mortales.

Pero, de tanto morirnos
al menos nos hemos ganado el derecho
de decidir cómo queremos morir.

Jesusa Rodríguez y Liliana Felipe.

miércoles, 20 de agosto de 2008

XIII


- ¿Qué es el alma, mamá?
- Es tu palabra.
- ¿Y no se mancha?
- Las lágrimas no manchan.
Son calientes, hermosas, necesarias.
- Yo te hablo del alma.
!No te estoy preguntando por las lágrimas!
- Pero es que el alma es todo:
allí nacen las ganas,
las risas, las sonrisas,
el desaliento, la esperanza.
- ¿Y se puede tocar?
- A cada instante.
Es como un beso de pestañas.
Lo mismo que una mano sobre otra.
- Bueno, te aviso por las dudas,
que en la calle me esperan unos chicos
para romperme el alma...

María Isabel Constela

domingo, 17 de agosto de 2008

Hongo

...

y qué es lo que vas a decir
voy a decir solamente algo
y qué es lo que vas a hacer
voy a ocultarme en el lenguaje
y porqué
tengo miedo

Alejandra Pizarnik

viernes, 15 de agosto de 2008

Lie Lie Lie



Serj Tankian

jueves, 14 de agosto de 2008

Mescalito ya viene a buscarte


Lunes, 7 de agosto, 1961

Llegué a la casa de Don Juan en Arizona la noche del viernes, a eso de las siete. Otros cinco indios estaban sentados con él en el zaguán de su casa. Lo saludé y tomé asiento esperando que alguien dijera algo. Tras un silencio formal, uno de los hombres se levantó, vino a mí y dijo: "Buenas noches". Me levanté y respondí: "Buenas noches". Entonces todos los otros se pusieron de pie y se acercaron y todos murmuramos "buenas noche" y nos dimos la mano, tocando apenas las puntas de los dedos del otro o bien sosteniendo la mano un instante y luego dejándola caer con brusquedad.
Todos nos sentamos de nuevo. Parecían algo tímidos: sin saber qué decir, aunque todos hablaban español.
Como a las siete y media, todos se levantaron de repente y fueron hacia la parte trasera de la casa. Nadie había pronunciado palabra en largo rato. Don Juan me hizo seña de seguirlos y todos subimos a una camioneta de carga estacionada allí. Yo iba en la parte trasera, con Don Juan y dos hombres más jóvenes. No había cojines ni bancas y el piso de metal resultó dolorosamente duro, sobre todo cuando dejamos la carretera y nos metimos por un camino de tierra. Don Juan susurró que íbamos a la casa de un amigo suyo, quien tenía siete mescalitos para mí.
-¿Usted no tiene don Juan?- le pregunté.
-Sí, pero no te los puedo ofrecer. Verás: otra gente tiene que hacerlo.
-¿Puede decirme por qué?
-A lo mejor "él" no te ve con agrado o no le caes bien, entonces nunca podrás conocerlo con afecto, como debe ser, y nuestra amistad quedará rota.
-¿Por qué no iba a caerle bien? Nunca le he hecho nada.
-No tienes que hacer nada para caer bien o mal. O te acepta o te tira de lado.
-Pero si no me acepta, ¿hay algo que puedo yo hacer para caerle bien?
Los otros dos hombres parecieron haber oído mi pregunta y rieron.
-No! No se me ocurre nada que pueda uno hacer- dijo Don Juan.
Volvió la cara a un lado y ya no pude hablarle.
Debimos haber viajado al menos una hora antes de detenernos frente a una casa pequeña. Estaba bastante oscuro, y una vez que el conductor hubo apagado los faros, yo apenas discernía el contorno vago del edificio.
Una mujer joven, mejicana a juzgar por la inflexión de su voz, le gritaba a un perro para hacerlo cesar sus ladridos. Bajam0os de la camioneta y entramos a la casa. Los hombres murmuraban "buenas noche" al pasar junto a la mujer. Ella respondía y continuaba gritándole al perro.
La habitación era amplia y contenía pilas de objetos diversos. La luz opaca de un foco eléctrico muy pequeño hacía la escena bastante lóbrega. Reclinadas contra la pared había varias sillas con patas rotas y asientos hundidos. Tres de los hombres se instalaron en un sofá, el mueble más grande del aposento. Era muy viejo y se había vencido hasta el piso; a la luz indistinta, parecía rojo y sucio. Los demás ocupamos sillas. Estuvimos largo rato sentados en silencio.
De pronto, uno de los hombres se levantó y fue a otro cuarto. Tendría cincuenta y tantos años; era moreno, alto, fornido. Regresó al momento con un frasco de café, quitó la tapa y me lo dio; dentro había siete cosas de aspecto raro. Variaban en tamaño y consistencia. Algunas eran casi redondas, otras alargadas. Se sentían al tacto como la pulpa de la castaña o la superficie del corcho. Su color pardusco se asemejaba a cáscaras de nuez duras y secas. Las manipulé, frotándolas un buen rato.
-Esto se masca- dijo Don Juan en un susurro.
Sólo cuando habló me di cuenta de que se había sentado junto a mí. Miré a los otros hombres, pero ninguno me miraba; estaban hablando entre sí en voz muy baja. Fue un momento de indecisión y temor agudos. Me sentí casi incapaz de dominarme.
-Tengo que ir al retrete- le dije - voy afuera a dar una vuelta.
Don Juan me entregó el frasco de café y yo puse dentro los botones de peyote. Iba a salir de la habitación cuando el hombre que me había dado el frasco se levantó, se me acercó y me dijo que tenía un excusado en el otro cuarto.
El excusado estaba casi contra la puerta. Junto a esta, casi tocándolo, había una cama grande que llenaba más de la mitad del aposento. La mujer estaba durmiendo allí. Permanecí un rato inmóvil junto a la puerta; luego regresé a la habitación donde estaban los otros hombres.
El dueño de la casa me habló en inglés:
-Don Juan dice que usted es de Sudamérica, ¿hay mescal allí?
Le dije que nunca había oído siquiera hablar de él.
Parecían interesados en Sudamérica y hablamos de los indios durante un rato. Luego uno de los hombres me preguntó por qué quería comer peyote. Le dije que quería saber como era. Todos rieron con timidez.
Don Juan me urgió suavemente:
-Masca, masca.
Mis manos se hallaban húmedas y mi estómago se contraía. El frasco con los botones de peyote estaba en el piso junto a la silla. Me agaché, tomé al azar un botón y lo puse en mi boca. Tenía un sabor rancio. Lo partí en dos con los dientes y empecé a mascar uno de los trozos. Sentí un amargor fuerte, acerbo; en un momento toda mi boca quedó adormecida. El amargor crecía conforme yo mascaba, provocando un increíble fluir de saliva. Sentía las encías y el interior de la boca como si hubiera comido carne o pescado salados y secos, que parecen forzar a masticar más. Tras un rato masqué el otro pedazo; mi boca estaba tan entumecida que ya no pude sentir el amargor. El botón de peyote era un haz de hebras, como la parte fibrosa de una naranja o como caña de azúcar, y yo no sabía si tragarlo o escupirlo. En ese momento, el dueño de la casa se puso en pié e invito a todos a salir al zaguán.
Salimos y nos sentamos en la oscuridad. Afuera se estaba bastante cómodo, y el anfitrión sacó una botella de tequila.
Los hombres se hallabas sentados en fila con la espalda contra la pared. Yo ocupaba el extremo derecho de la fila. Don Juan, instalado junto a mí, puso entre mis piernas el frasco con los botones de peyote. Luego me pasó la botella, que circulaba a lo largo de la línea y me dijo que tomara algo de tequila para sacarme el sabor amargo.
Escupí las hebras del primer botón y tomé un sorbo. Me dijo que no lo tragara, que sólo me enjuagara la boca para detener la saliva. No sirvió de gran cosa para la saliva, peo si ayudó a disipar un poco el sabor amargo.
Don Juan me dió un trozo de albaricoque seco, o quizá era un higo seco -no podía verlo en la oscuridad, ni percibir el sabor- y me dijo que lo mascara detenida y lentamente, sin prisas. Tuve dificultad para tragarlo; parecía que no quisiera bajar.
Tras una pausa corta la botella dió otra vuelta. Don Juan me entregó un pedazo de carne seca, quebradiza. Le dije que no tenía ganas de comer.
-Esto no es comer- dijo con firmeza.
El ciclo se repitió seis veces. Recuerdo que había mascado seis botones de peyote cuando la conversación se puso muy animada; aunque yo no lograba distinguir en que idioma se estaba hablando, el tema de la conversación en la que todo mundo participaba, era muy interesante, y procuré escuchar con cuidado para poder intervenir. Pero al hacer el intento de hablar me di cuenta de que no podía; las palabras se desplazaban sin objeto en mi mente.
Reclinando la espalda contra la pared, escuché lo que decían los hombres hablaban en italiano y repetían una frase sobre la estupidez de los tiburones. El tema me pareció lógico y coherente. Yo había dicho antes a Don Juan que los españoles llamaron al Río Colorado, en Arizona, "el río de los tizones", y alguien escribió o leyó mal "tizones" y el río se llamó de los "tiburones". Me hallaba seguro de que discutían esa anécdota, pero nunca se me ocurrió pensar que ninguno de ellos sabía italiano.
Tenía un deseo muy fuerte de vomitar, pero no recuerdo el acto en sí. Pregunté si alguien me traía un vaso de agua. Experimenté una sed insoportable.
Don Juan trajo una cacerola grande. La puso en el suelo junto a la pared. También trajo una lata o taza pequeña. La llenó en la cacerola y me la dió, y dijo que yo no podía beber: sólo debía refrescarme la boca.
El agua parecía extrañamente brillante, reluciente, como barniz espeso. Quise preguntarle de ellos a Don Juan y laboriosamente traté de formular mis pensamientos en inglés, pero entonces tomé conciencia de que él no sabía inglés. Experimenté un momento muy confuso y advertí el hecho de que, aun habiendo en mi mente un pensamiento muy claro no podía hablar. Quería comentar la extraña apariencia del agua, pero lo que sobrevino no fue habla; fue sentir que mis pensamientos no dichos salían de mi boca en una especie de forma líquida. Era la sensación de vomitar sin esfuerzo, sin contracciones del diafragma. Era un fluir agradable de palabras líquidas.
Bebí, y la impresión de que estaba vomitando desapareció. Para entonces todos los ruidos se habían desvanecido y hallé que me costaba trabajo enfocar las cosas. Busqué a Don Juan y al volver la cabeza, noté que mi campo de visión se había reducido a una zona circular frente a mis ojos. Esta sensación no me atemorizaba ni me inquietaba; al contrario, era una novedad: me era posible barrer literalmente el terreno enfocando un sitio y luego moviendo despacio la cabeza en cualquier dirección. Al salir al zaguán había advertido que todo estaba oscuro, excepto el brillo distante de la luces de la ciudad. Pero dentro del área circular de mi visión todo era claro. Olvidé mi interés en Don Juan y los otros hombres, y me entregué por entero a explorar el terreno con un enfoque absolutamente preciso.
Vi la junta de la pared y el piso del zaguán. Lentamente volví la cabeza a la derecha, siguiendo el muro, y vi a Don Juan sentado contra él. Moví la cabeza a la izquierda para enfocar el agua. Hallé el fondo de la cacerola; alcé ligeramente la cabeza y vi acercarse un perro negro de tamaño mediano. Lo vi venir hacia el agua. El perro empezó a beber. Alcé mi mano para apartarlo de mi agua; enfoqué en él mi visión concentrada para llevar a cabo el movimiento de empujarlo, y de pronto lo vi transparentarse. El agua era un líquido reluciente, viscoso. La vi bajar por la garganta del perro al interior de su cuerpo. La vi correr pareja a todo lo largo del animal y luego brotar por cada uno de los pelos. Vi el fluido iridiscente viajar a lo largo de cada pelo individual y proyectarse más allá de la pelambre para formar una melena larga, blanca, sedosa.
En ese momento tuve la sensación de unas convulsiones intensas, y en cosa de instantes un túnel se formó a mí alrededor, muy bajo y estrecho, duro y extrañamente frío. Parecía al tacto una pared de papel aluminio sólido. Me encontré sentado en el piso del túnel, se comprimió hasta empezar a sofocarme. Recuerdo haber tenido que reptar hacia una especie de punto redondo donde terminaba el túnel; cuando por fin llegué, si es que llegué, me había olvidado por completo del perro, de Don Juan y de mi mismo. Me hallaba exhausto. Mis ropas estaban empapadas en un líquido frío, pegajoso. Rodé en una y en otra dirección tratando de encontrar una postura en la cual descansar, una postura en la que mi corazón no golpeara tan fuerte. En una de esas vueltas vi de nuevo al perro.
Los recuerdos regresaron en el acto, y de improviso todo estuvo claro en mi mente. Me volví en busca de don Juan, pero no pude distinguí nada ni a nadie. Todo cuanto podía ver era al perro, que se volvía iridiscente; una luz intensa irradiaba de su cuerpo. Vi otra vez el flujo de agua atravesarlo, encenderlo como una hoguera. Me llegué al agua, hundí el rostro en la cacerola y bebí con él. Tenía yo las manos en el suelo frente a mí, y al beber veía el fluido correr por mis venas produciendo matices de rojo amarillo y verde. Bebí más y más. Bebí hasta hallarme todo en llamas; Resplandecía de pies a cabeza. Bebí hasta que el fluido salió de mi cuerpo a través de cada poro, y se proyectó hacia el exterior en fibras como de seda, y también yo adquirí una melena larga, lustrosa, iridiscente. Miré al perro y su melena era como la mía. Una felicidad suprema llenó mi cuerpo, y corrimos juntos hacia una especie de tibieza amarilla procedente de algún lugar indefinido. Y allí jugamos. Jugamos y forcejeamos hasta que yo supe sus deseos y él supo los míos. Nos turnábamos para manipularnos mutuamente, al estilo de una función de marionetas. Torciendo los dedos de los pies, yo podía hacerle mover las patas, y cada vez que él cabeceaba, yo sentía un impulso irresistible de saltar. Pero su mayor travesura consistía en agitar las orejas de un lado a otro para que yo, sentado, me rascara la cabeza con el pie. Aquella acción me parecía total e insoportablemente cómica. Qué toque de ironía y de gracia, qué maestría!, pensaba yo. Me poseía una euforia indescriptible. Reí hasta que casi me fue imposible respirar.
Tuve la clara sensación de no poder abrir los ojos; me encontraba mirando a través de un tanque de agua. Fue un estado largo y muy doloroso, lleno de la angustia de no poder despertar y de a la vez, estar despierto. Luego, lentamente, el inundo se aclaró y entro en foco. Mi campo de visión se hizo de nuevo muy redondo y amplio, y con ello sobrevino un acto consciente ordinario, que fue volver la vista en busca de aquel ser maravilloso. En este punto empezó la transición más difícil. La salida de mi estado normal había salido casi sin que yo me diera cuenta: estaba consciente, mis pensamientos y sentimientos eran un corolario de esa conciencia, y el paso fue suave y claro. Pero este segundo cambio, el despertar a la conciencia seria, sobria, fue genuinamente violento. Había olvidado que era un hombre!!! La tristeza de tal situación irreconciliable fue tan intensa que lloré.

Las enseñanzas de don Juan (una forma yaqui de conocimiento)
Carlos Castaneda

martes, 12 de agosto de 2008

Contigo

Yo no quiero un amor civilizado,
con recibos y escena del sofá;
yo no quiero que viajes al pasado
y vuelvas del mercado
con ganas de llorar.

Yo no quiero vecínas con pucheros;
yo no quiero sembrar ni compartir;
yo no quiero catorce de febrero
ni cumpleaños feliz.

Yo no quiero cargar con tus maletas;
yo no quiero que elijas mi champú;
yo no quiero mudarme de planeta,
cortarme la coleta,
brindar a tu salud.

Yo no quiero domingos por la tarde;
yo no quiero columpio en el jardin;
lo que yo quiero, corazón cobarde,
es que mueras por mí.

Y morirme contigo si te matas
y matarme contigo si te mueres
porque el amor cuando no muere mata
porque amores que matan nunca mueren.

Yo no quiero juntar para mañana,
no me pidas llegar a fin de mes;
yo no quiero comerme una manzana
dos veces por semana
sin ganas de comer.

Yo no quiero calor de invernadero;
yo no quiero besar tu cicatriz;
yo no quiero París con aguacero
ni Venecia sin tí.

No me esperes a las doce en el juzgado;
no me digas "volvamos a empezar";
yo no quiero ni libre ni ocupado,
ni carne ni pecado,
ni orgullo ni piedad.

Yo no quiero saber por qué lo hiciste;
yo no quiero contigo ni sin ti;
lo que yo quiero, muchacha de ojos tristes,
es que mueras por mí.

Y morirme contigo si te matas
y matarme contigo si te mueres
porque el amor cuando no muere mata
porque amores que matan nunca mueren.

Joaquin Sabina

viernes, 8 de agosto de 2008

Vincent



Tim Burton

jueves, 7 de agosto de 2008

V

Qué lejos de los procedimientos el amor!
La ley con os ojos vendados
haciéndose justicia por si misma!
Cuando unos forajidos armados
gritan a las puertas humildes "abran!"
y casi sin respuesta continúan
"abran o derribamos", el hombre humilde
entiende -sin tramo filosófico posible-
que de allí en mas, fuerzas extrañas a la naturaleza
lo han atrapado. ¿o acaso lo perdonen?
¿O tal vez lo investiguen? ¿O lo torturen?
¿O lo maten?
De allí en adelante pasará a ser un sujeto
que no sujeta nada, apenas un objeto a disposición,
¿investigado, olido, castigado, absuelto, liberado?
Advierte claramente que las fuerzas disponen del poder.
Que ambas proceden duramente. Ciegamente.
Súbitamente entiende que su energía
se debe concentrar en la prudencia.
Su esfuerzo consistirá en hablar de sí mismo
respondiendo sí o no, cuando ese sí le convenga
cuando ese no le sirva.
Advierte lúcidamente que no hay de qué temer
que le venden los ojos, porque ese otro objeto
que actúa en nombre de la ley evita que el
pavor de sus ojos descubra la oblicua cobardía de los suyos.
Reconozca (en el mayor de los silencios)
que el escalofrio que hace temblar las manos
que lo ciegan no quedará prendido al nudo firme.
Y reconozca
que es grande el privilegio
que ha gozado
de mirarse al espejo dignamente.

María Isabel Constela

The last knit

sábado, 2 de agosto de 2008

jueves, 31 de julio de 2008

Genoma y ancestros comunes

El texto que sigue muestra cómo los vasos comunicantes que generaron biólogos y matemáticos que trabajan en la frontera del conocimiento, permitieron poner en evidencia (una vez más) la existencia de ancestros comunes.
Durante 2005, en una charla que manteníamos en un café de la Facultad de Exactas (UBA) con Alicia Dickenstein (matemática y una de mis mejores amigas, una persona que claramente tuvo una iniciativa muy positiva en mi vida), ella me comentó acerca e un trabajo muy interesante que involucró a biólogos y matemáticos. Más precisamente, me contó el resumen del trabajo "The Mathematics of Phylogenomics", escrito por Lior Pachter y Bernd Sturmfels, del Departamento de Matemáticas de UC Berkeley.
Desde el momento en que, en el 2003, se completó el Proyecto Genoma Humano (HGP, de acuerdo con la sigla en inglés, Human Genome Proyect), comenzó también la carrera por conocer e identificar a nuestros antepasados, y saber con quiénes compartimos ese "privilegio". El Proyecto, que duró más de trece años, permitió identificar a los (aproximadamente) entre 20.000 y 25.000 genes del genoma humano, y determinar las secuencias de los 3.000 millones de pares de bases químicas que lo componen. Es decir, es como si uno tuviera un alfabeto que consista en nada mas que 4 letras: A, T, C y G (las iniciales de Adenina, Timina, Citocina y Guanina). El ADN de una persona es algo así como una cédula de identidad. Ahí está escrita toda la información necesaria para el funcionamiento de sus células y sus órganos. En esencia, en una molécula de ADN está inscripto todo o que podemos ser, nuestras particulares aptitudes y capacidades,y algunas de las enfermedades que podemos padecer. No obstante, es la combinación de esa información con el aporte del medio ambiente lo que hace que cada uno de nosotros sea único.

Esa doble hélice es una especie de serpentina que tiene escritas dos tiras enfrentadas de largas cadenas de esas cuatro letras. Pero, además, posee una particularidad: si en una de las tiras, en un lugar hay una letra A, entonces en el lugar correspondiente de la otra tiene que haber una letra T, y si hay una C, entonces en la otra tiene que haber una G. Es decir que vienen apareadas. (De hecho, una forma de recordar esta particularidad, entre los amantes del tango, es usar las iniciales de Anibal Troilo y Carlos Gardel.)
Ahora bien, ¿a qué viene todo estoque parece más asociado a un artículo sobre biología molecular que a algo que tenga que ver con la matemática? En el artículo que mencionamos de Lior Pachter y Bernd Sturmfels, y también en el libro Algebraic Stadistics for Computational Biology (Cambridge University Press, 2005), los autores estudiaron una situación muy particular. Miren esta porción de ADN:

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG

Son 42 letras, en el orden en el que están escritas. Para decirlo de otra manera, sería como una palabrade 42 letras. Esta "tira" del genoma fue encontrada (después de un arduo trabajo matemático y comutacional de "alineación" de las distintas secuencias) en algún lugar del ADN de los siguientes vertebrados: hombre, chimpancé, ratón, rata, perro, pollo, rana, peces...
Si uno tirara un dado, que en lugar de tener las seis caras convencionales, tuviera sólo cuatro lados, rotulados A, T, C y G la probabilidad estimada de que esta secuencia de 42 letras apareciera en ese orden es de 1 dividido por 10 elevado a la 50 potencia. Es decir, la probabilidad de que esto haya ocurrido por azar es aproximadamente igual a 10 elevado a la -50 que es igual a 0,000000...0001. Para decirlo de otro modo el número empezaría con un cero y luego de la coma habría 49 ceros, y sólo entonces un número uno. Justamente, la rpobabilidad de que esto ocurra es tan baja que permite a los autores del artículo conjeturar que todos ellos tuvieron un antepasado o un ancestro común (probablemente hace unos quinientos millones de años), que ya poseía esa secuencia de 42 bases, que fue heredada intacta por todos los descendientes de las distintas ramas de vertebrados. Por lo tanto, si bien uno no puede hablar de certeza, la probabilidad de que el hombre tenga el mismo origen que un pollo, o un perro, o un ratón (ni hablar de un chimpancé), es altísima.

Adrián Paenza

domingo, 27 de julio de 2008

¿4 millones de años de evolución para llegar a esto?


El Australopithecus es el homínido más antiguo que se conoce. Australopithecus quiere decir "simio sudafricano" y se estima su antigüedad hasta en 4 millones de años.
La alimentación del hombre prehistórico dependía básicamente de la recolección de plantas, tubérculos y otros vegetales, así como de la ingestión de insectos, huevecillos de insectos y animales pequeños.
Una o más subespecies del Homo erectus evolucionaron hasta llegar al Homo sapiens, un nuevo tipo físico. Los restos más antiguos del Homo sapiens tienen una edad entre 250 mil y 50 mil años. En sentido estricto se le denomina homo sapiens neanderthalis: el hombre de Neanderthal.
Los neandertales estaban más capacitados y eran mentalmente más avanzados que ningún otro ser que hubiera habitado en la Tierra anteriormente.
El hombre de Neanderthal desapareció bruscamente, su lugar fue ocupado por los hombres modernos, hace unos 35 mil años.
Después del Neanderthal vino el Homo sapiens sapiens, que es la especie a la cual pertenecemos los seres humanos modernos. La supervivencia de la humanidad durante el Paleolítico se logró en gran medida a la vida comunitaria, el ingenio, los descubrimientos técnicos y la capacidad social que desarrolló para comunicar y guardar la memoria de su cultura.
Lo que dio al hombre moderno su control sobre la Tierra no fue su físico, sino su capacidad de aprovechar y transmitir a sus descendientes la información cultural por medio de su inteligencia.
Luego de muchos miles de años de evolución, podríamos decir que el ser humano ha avanzado mucho tecnológicamente, aunque no ha podido hacerlo al mismo ritmo, ni emocional ni espiritualmente.
No hemos podido hacer que primen en nuestra conducta los actos de bondad, de solidaridad y de amor y mucho menos erradicar males de nuestra sociedad como las guerras, la depredación de los recursos naturales, los odios étnicos o religiosos.
Llegamos posiblemente al momento menos racional de nuestra historia, al mas violento, mas injusto y con mayor diferencia entre ricos y pobres; tenemos la mayor capacidad destructiva y estamos cada vez mas sometidos a la caprichosa voluntad de grupos cada vez mas pequeños.
Sin embargo y en contraposición, tenemos también la mayor cantidad de conocimientos acumulados sobre la naturaleza, sobre biología, medicina, astronomía y todas las ramas de la ciencia. Tenemos los conocimientos necesarios para modificar desde el ADN hasta el clima del planeta entero.
Nuestra especie está en un momento de su historia en el que debe decidir si seguirá el camino de la civilización o la barbarie, el de la violencia o el amor, el de la depredación o la sustentabilidad.
Es la primera vez que debemos decidir universalmente, como especie, a nivel global. Pero es una decisión que definitivamente no podemos dejar en manos de los pocos que vienen rigiendo los caminos que ha tomado la humanidad en los últimos decenios, porque si la decisión es incorrecta, también es muy posible que sea la última.
Decidir correctamente significa Acción. Significa luchar por los derechos humanos en su acepción mas amplia. Los del pasado, los del presente y los de las generaciones futuras. Contra la deforestación y por la redistribución de la riqueza. Contra las guerras y porque haya acceso al agua potable para todos. Contra los transgénicos y los agrotóxicos y por la paz en el mundo y por la libertad de los cinco. Contra la explotación del hombre por el hombre y por el acceso a la salud, educación, vivienda y trabajo. Contra el hambre en el mundo y por el fin de la sociedad de consumo. No importa en cual frente de lucha nos encontremos, si su fin último es lograr un ambiente sano y una vida digna para todos y todas, es que estamos en el mismo camino, uno que nos garantiza la supervivencia de la humanidad.

Ricardo Natalichio

domingo, 20 de julio de 2008

El Aplastamiento de las gotas

...cementerio de gotas... El Galpón - Salta


Yo no sé, mira, es terrible cómo llueve. Llueve todo el tiempo, afuera tupido y gris, aquí contra el balcón con goterones cuajados y duros, que hacen plaf y se aplastan como bofetadas uno detrás de otro qué hastío. Ahora aparece una gotita en lo alto del marco de la ventana; se queda temblequeando contra el cielo que la triza en mil brillos apagados, va creciendo y se tambalea, y va a caer y no se cae, todavía no se cae. Está rendida con todas las uñas, no quiere caerse y se la ve que se agarra con los dientes mientras le crece la barriga; ya es una gotaza que cuelga majestuosa, y de pronto zup, ahí va, plaf, deshecha, nada, una viscosidad en el mármol.
Pero las hay que se suicidan y se entregan en seguida, brotan en el marco y ahí mismo se tiran; me parece ver la vibración del salto, sus piernitas desprendiéndose y el grito que las emborracha en esa nada del caer y aniquilarse. Tristes gotas, redondas inocentes gotas. Adiós gotas. Adiós.

Julio Cortázar

jueves, 17 de julio de 2008

Y si miras atras...


Una galleta de barro es lo único que pueden llevarse a la boca cientos de personas que sobreviven en países como Haití. En este país, familias enteras tan sólo pueden permitirse comprar en el mercado estas “galletas” que cuestan tres céntimos de euro. Una taza de arroz, son 20 céntimos.

Más de mil millones de personas sobreviven con menos de un dólar al día, algunos de ellos con menos de 15 céntimos, como ocurre en Puerto Príncipe y tantos otros lugares del mundo. Sin embargo, en los países del Norte nos preocupamos por el último modelo de celular o la nueva colección de Prada.

Las desigualdades no han dejado de crecer en un mundo, donde por primera vez en la historia, existen los recursos, el conocimiento y las tecnologías para erradicar el hambre. Hoy, el 40% más pobre de la población del planeta recibe sólo el 5% del total del ingreso mundial. Pero, además, la brecha de desigualdad interior está debilitando el vínculo entre el crecimiento económico y la reducción de la pobreza. El PNUD señala que el 10% más pobre de los brasileños es más pobre que sus contrapartes de Vietnam, un país con un nivel de ingreso menor. Estas desigualdades internas, también, se están dejando notar en los países ricos. En EEUU, el país más rico del mundo, estaban creciendo los niveles de pobreza y son 37 millones los estadounidenses que viven bajo el umbral de la pobreza, según el censo de 2004.

La pobreza no es un estado para llegar al bienestar. La pobreza existe porque hay otros que derrochan los recursos, que son de todos. Basta la cuestión del agua, como ejemplo. Hoy se pueden destinar más de 43.000 kilómetros cúbicos al consumo de agua, sin embargo, tan sólo se consumen 6.000 kilómetros cúbicos. Y el 60% de esa agua potable lo consumen nueve, privilegiados, países.

El cumplimiento de los Objetivos de Desarrollo del Milenio se convierten, hoy más que nunca, en un must. Más de 25.000 personas mueren cada día por causas relacionadas con la desnutrición, 1.200 millones de personas no tienen acceso al agua potable, 800 millones de niños y niñas no acuden a la escuela, 10 millones de niños murieron en 2006 por enfermedades para las que existen tratamientos… Cifras que no pueden dejarnos indiferentes, porque se trata de personas.

Nadie elige dónde quiere nacer. Sin embargo, esa “lotería” es lo que marca cómo va a ser su vida. Si el niño que nace lo hace en el club de los privilegiados, es posible que estudie en la Universidad, acuda de manera regular al médico y no se preocupará por lo que tiene de cena, es más, podrá elegir e, incluso, preocuparse por “tener buena línea”. Sin embargo, si por casualidad al niño le toca nacer en el mundo empobrecido, ese niño tendrá “suerte” si consigue sobrevivir y llegar a ser adulto.

Un comercio internacional más justo, una auténtica ayuda al desarrollo, mejora en la calidad de la educación y la sanidad, el fin de los paraísos fiscales y el control de la explosión demográfica, son elementos fundamentales para hacer de este un mundo más justo. La sociedad civil organizada no puede esconderse más. Ha llegado el tiempo de la acción y la exigencia para que organismos internacionales y gobiernos pongan en marcha las medidas para acabar con el hambre en el mundo.

La alimentación debería ser considerada un derecho fundamental de la persona. Nadie debería alimentarse de galletas de barro, que se elaboran con la tierra acumulada en los suburbios de las ciudades, en los basureros… donde los parásitos y los tóxicos las convierten en auténtico veneno. Pero, cuando el mercado cierra, todavía los más parias de este mundo acuden para tomar los pedazos de “galletas” que se han roto.

Como finaliza la fábula, “y si miras atrás, siempre hay alguien que recogerá tus migas”.

Ana Muñoz

martes, 15 de julio de 2008

Carta de despedida del Che a sus hijos


A mis hijos

Queridos Hildita, Aleidita, Camilo, Celia y Ernesto:

Si alguna vez tienen que leer esta carta, será porque yo no esté entre Uds.

Casi no se acordarán de mi y los más chiquitos no recordarán nada.

Su padre ha sido un hombre que actúa como piensa y, seguro, ha sido leal a sus convicciones.

Crezcan como buenos revolucionarios. Estudien mucho para poder dominar la técnica que permite dominar la naturaleza. Acuérdense que la revolución es lo importante y que cada uno de nosotros, solo, no vale nada. Sobre todo, sean siempre capaces de sentir en lo más hondo cualquier injusticia cometida contra cualquiera en cualquier parte del mundo. Es la cualidad más linda de un revolucionario.

Hasta siempre hijitos, espero verlos todavía. Un beso grandote y un gran abrazo de

Papá

martes, 8 de julio de 2008

En los brazos del sol - La Renga

La Pampa - Argentina

Padre de la Luz, de la luz primera,
y por eso rey de toda luz.
Alma visible del dios que ciega
Y abraza las llamas de su propia cruz.

En esta nuestra justa distancia
Si me acerco me querrás quemar
En esta nuestra justa distancia,
si me alejo me dejarás helar.

Ojo de fuego de toda esta mente
Acá me seco con tu rayo hoy,
Cuando llegue el fin aún será de día
Pobre quien no sude tu calor.

En esta nuestra justa distancia
Si me acerco me querrás quemar
En esta nuestra justa distancia,
si me alejo me dejarás helar.

martes, 10 de junio de 2008

Por si tienes alguna duda...

Tienes que ver estos videos en ese orden porque es uno solo dividido en 3 partes. En realidad es mas largo (pero en lo demás no habla de la religión) y puedes encontrar las otras partes en youtube. El video se llama "zeitgeist" (espiritu del tiempo)


viernes, 23 de mayo de 2008

Demian

Puerto San Julián - Patagonia Argentina

... tuve una vez un sueño en el que volaba; pero de manera tal que me sentía lanzado por los aires con un gran impulso, que no controlaba. La sensación de aquel vuelo era grandiosa,pero pronto se convertñía en angustia al verme arrebatado hacia alturas peligrosas sin poder evitarlo. Entonces descubrí que podia regular mis subidas y bajadas conteniendo o soltando el aire de los pulmones.
A esto, Pistorius dijo:el impulso que le hace a usted volar es nuestro patrimonio humano, que todos poseemos. Es el sentimiento de unión con las raíces de toda fuerza. Pero pronto nos asalta el miedo. Es tan peligroso! Por eso la mayoria renuncia tan gustosamente a volar y prefiere caminar de la mano de los preceptos legales o por la acera. Usted no. Usted sigu volando, como se debe. Y entonces descubre lo maravilloso; descubre que lentamente se hace dueño de la situación; que ala gran fuerza general que le arrastra corresponde una pequeña fuerza propia, un timón...

Hermann Hesse

miércoles, 21 de mayo de 2008

Hablando de la Libertad - La Renga

Puerto San Julián - Patagonia Argentina

Hice a mi cuerpo amigo del cielo y la distacia
y me fui a buscarle una verdad a mi corazon.
Algo tan grande como el cielo y las montañas
y tan pequeño como una gota de rocio.
Y ya no estubo mas conmigo mi corazon,
se fue a posar en cada una de las cosas;
y ya no estubo mas conmigo mi corazon,
se fue a fundir con la escencia y la sabia.
Y ahora solo un camino he de caminar,
cualquier camino que tenga corazon.
Atravezando todo su largo sin aliento,
dejando atras mil razones en el tiempo.
Y morir queriendo ser libre, encontrar mi lado salvaje,
ponerle alas a mi destino,
romper los dientes de este engranaje.

Hice un lugar en el refugio de mis sueños
y guarde ahi mi tesoro mas preciado.
Donde no llega el hombre con sus jaulas
ni la maquinaria de la supervivencia.
Me fue mas facil, intentar la vida,
que venderla al intelecto y la conformidad.

Y ahora solo un camino he de caminar,
cualquier camino que tenga corazon.
Atravezando todo su largo sin aliento
dejando atraz mil razones en el tiempo.
Morir queriendo ser libre, encontrar mi lado salvaje,
ponerle alas a mi destino,
romper los dientes de este engranaje

domingo, 6 de abril de 2008

Paja Brava - La Renga


En la tierra crece hierba buena
con la lluvia y el rayo de sol
pasadizo para el otro patio,
punto rojo, casita de Dios.
El beleño y la belladona,
amanita y la mandrágora
florecitas de mi tierra santa,
viajecito para el más allá.

Masca coca que ya estamos alto,
cañamo bueno pa´la tristeza.
Mescalito ya viene a buscarte,
venadito, peyote y maiz.

El cornezuelo y la ayaguasca,
el tornaloco y la salvia,
el San Pedro de los cuatro vientos,
el virola y el floripondio.

En la tierra crece hierba buena
con la lluvia y el rayo de sol
pasadizo para el otro patio,
punto rojo, casita de Dios

viernes, 29 de febrero de 2008

Dios no existe - Las paradojas de Bertrand Russell


Bertrand Russel vivió 97 años; desde 1872 hasta 1970. Nació en Inglaterra como miembro de una familia muy rica y ligada con la realeza británica. Vivió una vida llena de matices, abogó en contra de la guerra, peleó contra la religión (cualquier manifestación de ella), estuvo preso en varias oportunidades, se casó cuatro veces (la última a los 80 años) y tuvo multiples experiencias sexuales de las que siemre se mafestó orgulloso. Si bien fue uno de los grandes pensadores matematicos del siglo XX, ganó premio Nobel de Literatura en 1950. Fue frofesor en Harvard, en Cambridge y en Berkeley.
Dentro del terreno de la lógica, uno de los capítulos más interesantes tiene que ver con su célebre paradoja de los conjuntos que no se contienen a sí mismos como elementos.
Seguramente, de todas las ,maneras de presentar sus paradojas, esta es la más llamativa. Pretende probar que Dios no existe, nada menos.
Pongámonos primero de acuerdo con lo que quiere decir Dios. Por definición, la existencia de Dios esta igualada con la existencia de un ser todo poderoso. En la medida en que nosotros podamos probar que nada ni nadie puede ser omnipotente, entonces, nadie podrá adjudicarse el "ser Dios".
Vamos a probar esto por el absurdo; o sea, vamos a suponer que el resultado es cierto y eso nos va a llevar a una contradicción.
Supongamos que Dios existe. Entonces, como hemos dicho, en tanto que Dios, debe ser todopoderoso. Lo que vamos a hacer es probar que no puede haber nadie todopoderoso. o lo que es lo mismo, no puede haber nadie que tenga todos los
poderes.
Y hacemos así: si existiera alguien que tuviera todos los poderes, debería tener el poder de hacer piedras muy grandes. No le puede faltar este poder, poerque si no, ya demostraría que no es todopoderoso. Entonces concluímos en que tiene que tener el poder de hacer piedras muy grandes. No solo tiene que tener el poder de hacer piedras muy grandes, si no que tiene que hacer piedras tan grandes que el no pueda mover... no le tiene que faltar este poder (ni ningún otro si vamos al caso).
Ésta es la contradicción, porque si hay piedras que él no pueda mover, eso significa que le falta un poder. Y si a tales piedras no las puede hacer, eso significa que le falta ese poder. En definitiva, cualquiera que pretenda ser todopoderoso adolecera de un problema: o bien le falta el poder de hacer piedras tan grandes que él no pueda mover, o bien existen piedras que él no puede mover. De una u otra forma, no puede haber nadie todopoderoso (y eso era lo q queriamos probar).

Adrián Paenza

viernes, 22 de febrero de 2008

Los padres



Hace once años, en Montevideo, yo estaba esperando a Florencia en la puerta de la casa. Ella era muy chica, caminaba como un osito. Yo la veía poco, Me quedaba en el diario hasta cualquier hora y por las mañanas trabajaba en la Universidad. Poco sabía de ella. La besaba dormida; a veces le llevaba chocolatines o juguetes.

La madre no estaba, aquella tarde, y yo esperaba en la puerta de casa el ómnibus que traía a Florencia de la guardería.

Llegó muy triste. No hablaba. En el ascensor hacía pucheros. Después dejó que la leche se enfriara en el tazón. Miraba el piso.

La senté en mis rodillas y le pedí que me contara. Ella negó con la cabeza. La acaricié, la besé en la frente. Se le escapó alguna lágrima. Con el pañuelo le sequé la cara y la soné. Entonces, volví a pedirle:

-Andá, decime.

Me contó que su mejor amiga le había dicho que no la quería.

Lloramos juntos, no sé cuanto tiempo, abrazados los dos, ahí en la silla.

Yo sentía las lastimaduras que Florencia iba a sufrir a lo largo de los años y hubiera querido que Dios existiera y no fuera sordo, para poder rogarle que me diera todo el dolor que le tenía reservado.

Eduardo Galeano

martes, 19 de febrero de 2008

Tú me quieres blanca


Tú me quieres alba,
me quieres de espumas,
me quieres de nácar.
Que sea azucena
sobre todas, casta.
De perfume tenue.
Corola cerrada

Ni un rayo de luna
filtrado me haya.
Ni una margarita
se diga mi hermana.
Tú me quieres nívea,
tú me quieres blanca,
tú me quieres alba.

Tú que hubiste todas
las copas a mano,
de frutos y mieles
los labios morados.
Tú que en el banquete
cubierto de pámpanos
dejaste las carnes
festejando a Baco.
Tú que en los jardines
negros del Engaño
vestido de rojo
corriste al Estrago.

Tú que el esqueleto
conservas intacto
no sé todavía
por cuáles milagros,
me pretendes blanca
(Dios te lo perdone),
me pretendes casta
(Dios te lo perdone),
¡me pretendes alba!

Huye hacia los bosques,
vete a la montaña;
límpiate la boca;
vive en las cabañas;
toca con las manos
la tierra mojada;
alimenta el cuerpo
con raíz amarga;
bebe de las rocas;
duerme sobre escarcha;
renueva tejidos
con salitre y agua;
habla con los pájaros
y lévate al alba.
Y cuando las carnes
te sean tornadas,
y cuando hayas puesto
en ellas el alma
que por las alcobas
se quedó enredada,
entonces, buen hombre,
preténdeme blanca,
preténdeme nívea,
preténdeme casta.

Alfonsina Storni

domingo, 17 de febrero de 2008

martes, 12 de febrero de 2008

EL PERRO COJO



Con una pata colgando,
despojo de una pedrada,
pasó el perro por mi lado,
un perro de pobre casta.
Uno de esos callejeros,
pobres de sangre y estampa.
Nacen en cualquier rincón,
de perras tristes y flacas,
destinados a comer
basuras de plaza en plaza.
Cuando pequeños, qué finos
y ágiles son en la infancia,
baloncitos de peluche,
tibios borlones de lana,
los miman, los acurrucan,
los sacan al sol, les cantan.
Cuando mayores, al tiempo
que ven que se fue la gracia,
los dejan a su ventura,
mendigos de casa en casa,
sus hambres por los rincones
y su sed sobre las charcas.
Qué tristes ojos que tienen,
que recóndita mirada
como si en ella pusieran
su dolor a media asta.
Y se mueren de tristeza
a la sombra de una tapia,
si es que un lazo no les da
una muerte anticipada.
Yo le llamo: psss, psss, psss.
Todo orejas asustadas,
todo hociquito curioso,
todo sed, hambre y nostalgia,
el perro escucha mi voz,
olfatea mis palabras
como esperando o temiendo
pan, caricias... o pedradas,
no en vano lleva marcado
un mal recuerdo en su pata.
Lo vuelvo a llamar: psss, psss.
Dócil a medias avanza
moviendo el rabo con miedo
y las orejitas gachas.
Chasco los dedos; le digo:
"ven aquí, no te hago nada,
vamos, vamos, ven aquí".
Y adiós la desconfianza.
Que ya se tiende a mis pies,
a tiernos aullidos habla,
ladra para hablar más fuerte,
salta, gira; gira, salta;
llora, ríe; ríe, llora;
lengua, orejas, ojos, patas
y el rabo es un incansable
abanico de palabras.
Es su alegría tan grande
que más que hablarme, me canta.
"¿Qué piedra te dejó cojo?
Sí, sí, sí, malhaya".
El perro me entiende; sabe
que maldigo la pedrada,
aquella pedrada dura
que le destrozó la pata
y él, con el rabo, me dice
que me agradece la lástima.
"Pero tú no te preocupes,
ya no ha de faltarte nada.
Yo también soy callejero,
aunque de distintas plazas
y a patita coja y triste
voy de jornada en jornada.
Las piedras que me tiraron
me dejaron coja el alma.
Entre basuras de tierra
tengo mi pan y mi almohada.
Vamos, pues, perrito mío,
vamos, anda que te anda,
con nuestra cojera a cuestas,
con nuestra tristeza en andas,
yo por mis calles oscuras,
tú por tus calles calladas,
tú la pedrada en el cuerpo,
yo la pedrada en el alma
y cuando mueras, amigo,
yo te enterraré en mi casa
bajo un letrero: «aquí yace
un amigo de mi infancia».
Y en el cielo de los perros,
pan tierno y carne mechada,
te regalará San Roque
una muleta de plata.
Compañeros, si los hay,
amigos donde los haya,
mi perro y yo por la vida:
pan pobre, rica compaña.


Era joven y era viejo;
por más que yo lo cuidaba,
el tiempo malo pasado
lo dejó medio sin alma.
Y fueron muchas las hambres,
mucho peso en sus tres patas
y una mañana, en el huerto,
debajo de mi ventana,
lo encontré tendido, frío,
como una piedra mojada,
un duro musgo de pelo,
con el rocío brillaba.
Ya estaba mi pobre perro
muerto de las cuatro patas.
Hacia el cielo de los perros
se fue, anda que te anda,
las orejas de relente
y el hociquillo de escarcha.
Portero y dueño del cielo
San Roque en la puerta estaba:
ortopédico de mimos,
cirujano de palabras,
bien surtido de intercambios
con que curar viejas taras.
"Para ti... un rabo de oro;
para ti... un ojo de ámbar;
tú... tus orejas de nieve;
tú... tus colmillos de escarcha.
Y tú, -mi perro reía-,
tú... tu muleta de plata".
Ahora ya sé por qué está
la noche agujereada:
¿Estrellas... luceros...? No,
es mi perro cuando anda...
con la muleta va haciendo
agujeritos de plata.

Manuel Benítez Carrasco

sábado, 9 de febrero de 2008

Mira Vos

El Heroe Del Whisky


Mira vos donde fuiste a parar
y mira vos no querés regresar
a quién de todas ellas tengo que llamar
para tener la libertad corporal
y también mental

Mira vos donde fuiste a pasear
y mira vos no querés regresar
Tus ojos fueron cambiando un poco más...
como llorando te vas

Ya conoces las trampas
y sabes como zafar
Ya conocés el camino
entonces vas a regresar...
para matar
para matar

Amor que fue una traición
dejando roto su corazón
se miente solo y sabe que va a volver
como llorando te vas...
a regresar
para matar

La Nebulosa

miércoles, 6 de febrero de 2008

Charles Chaplin


"Ya perdoné errores casi imperdonables, traté de sustituir personas insustituibles y olvidar personas inolvidables.
Ya hice cosas por impulso, ya me decepcioné con personas cuando nunca pensé decepcionarme, mas también decepcioné a alguien.
Ya abracé para proteger, ya me reí cuando no podía, ya hice amigos eternos, ya amé y fui amado, pero también fui rechazado. Ya fui amado y no supe amar.
Ya grité y salté de tanta felicidad, ya viví de amor e hice juramentos eternos, pero también "rompí la cara" muchas veces.
Ya lloré escuchando música y viendo fotos, ya llamé solo para escuchar una voz, ya me enamoré por una sonrisa, ya pensé que iba a morir de tanta nostalgia, y tuve miedo de perder a alguien especial (y terminé perdiéndolo) ¡pero sobreviví! ¡Y todavía vivo!
No paso por la vida... y tú tampoco deberías pasar... ¡Vive!
Bueno es ir a la lucha con determinación, abrazar la vida y vivir con pasión, perder con clase y vencer con osadía, porque el mundo pertenece a quien se atreve y la vida es mucho para ser insignificante".

martes, 5 de febrero de 2008

Oda al gato


Los animales fueron
imperfectos,
largos de cola, tristes
de cabeza.
Poco a poco se fueron
componiendo,
haciéndose paisaje,
adquiriendo lunares,
gracia, vuelo.
El gato,
sólo el gato
apareció completo
y orgulloso:
nació completamente
terminado,
camina solo y sabe lo que
quiere.

El hombre quiere ser
pescado y pájaro,
la serpiente quisiera tener
alas,
el perro es un león
desorientado,
el ingeniero quiere ser
poeta,
la mosca estudia para
golondrina,
el poeta trata de imitar la
mosca,
pero el gato
quiere ser sólo gato
y todo gato es gato
desde bigote a cola,
desde presentimiento a
rata viva,
desde la noche hasta sus
ojos de oro.

No hay unidad
como él,
no tienen
la luna ni la flor
tal contextura:
es una sola cosa
como el sol o el topacio,
y la elástica línea en su
contorno
firme y sutil es como
la línea de la proa de una
nave.
Sus ojos amarillos
dejaron una sola
ranura
para echar las monedas
de la noche.

Oh pequeño
emperador sin orbe,
conquistador sin patria,
mínimo tigre de salón,
nupcial
sultán del cielo
de las tejas eróticas,
el viento del amor
en la intemperie
reclamas
cuando pasas
y posas
cuatro pies delicados
en el suelo,
oliendo,
desconfiando
de todo lo terrestre,
porque todo
es inmundo
para el inmaculado pie del
gato.

Oh fiera independiente
de la casa, arrogante
vestigio de la noche,
perezoso, gimnástico
y ajeno,
profundísimo gato,
policía secreta
de las habitaciones,
insignia
de un
desaparecido terciopelo,
seguramente no hay
enigma
en tu manera,
tal vez no eres misterio,
todo el mundo te sabe y
perteneces
al habitante menos
misterioso,
tal vez todos lo creen,
todos se creen dueños,
propietarios, tíos
de gatos, compañeros,
colegas,
discípulos o amigos
de su gato.

Yo no.
Yo no suscribo.
Yo no conozco al gato.
Todo lo sé, la vida y su
archipiélago,
el mar y la ciudad
incalculable,
la botánica,
el gineceo con sus
extravíos,
el por y el menos de la
matemática,
los embudos volcánicos
del mundo,
la cáscara irreal del
cocodrilo,
la bondad ignorada del
bombero,
el atavismo azul del
sacerdote,
pero no puedo descifrar un
gato.
Mi razón resbaló en su
indiferencia,
sus ojos tienen números
de oro.

Pablo Neruda